zgc:66306

Ensembl ID:
ENSDARG00000027140
ZFIN ID:
ZDB-GENE-040426-1603
Description:
nuclear pore complex protein Nup160 [Source:RefSeq peptide;Acc:NP_956956]
Human Orthologue:
NUP160
Human Description:
nucleoporin 160kDa [Source:HGNC Symbol;Acc:18017]
Mouse Orthologue:
Nup160
Mouse Description:
nucleoporin 160 Gene [Source:MGI Symbol;Acc:MGI:1926227]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6810 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38129 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14701 Nonsense Available for shipment Available now
sa6809 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24723 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123436 Essential Splice Site 68 1136 2 29
Genomic Location (Zv9):
Chromosome 25 (position 35785699)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34217031
GRCz11 25 34721989
KASP Assay ID:
554-4703.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACAGTGGGAAACTGCTGTCGGTCACCAGCAACAGATTCATCCACYGG[T/G]CAGAACTCTTCTGTTTTACCSCACTTYTCTTTCGTGTGCACTGRAAAACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123436 Essential Splice Site 418 1136 9 29
Genomic Location (Zv9):
Chromosome 25 (position 35777721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34209053
GRCz11 25 34714011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCGCCAGAGGAAGAAGTTCACATCGGAGAAGACCAAGATCCTCGGG[T/G]AAAAATACCGATACCCGATGCCGTCAAAACAGGGTGTCCGCTGGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123436 Nonsense 630 1136 15 29
Genomic Location (Zv9):
Chromosome 25 (position 35771517)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34202849
GRCz11 25 34707807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTGGGAACGTGATTGGCGACATTGCAAACAAACTGCAGGACATCTA[T/A]AACCCCAWCGCTGYCATGAACWTGCTGCTYCGAGAGCTGGACCTGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123436 Essential Splice Site 928 1136 22 29
Genomic Location (Zv9):
Chromosome 25 (position 35765690)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34197022
GRCz11 25 34701980
KASP Assay ID:
554-5198.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAGATGAAGAAACGGCGRCCGCTCCACGATTGCTTTACTACAACAAG[G/A]AAAGTCTGCTGTTCTAGATGCACTTAATTCTGCAGCATCTGAATGGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123436 Nonsense 938 1136 23 29
Genomic Location (Zv9):
Chromosome 25 (position 35765581)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34196913
GRCz11 25 34701871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGTGTTTTATTCTTACAGGTCCTGCGGTTATTGGAGGATATTGGGT[T/A]GCCGGAGCTTGTGATTGAATTGGCAACGCTGGCCGTTTCTGAAGCCACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link