si:dkeyp-122e7.1

Ensembl ID:
ENSDARG00000027079
ZFIN ID:
ZDB-GENE-070912-632
Description:
zinc finger protein 804A [Source:RefSeq peptide;Acc:NP_001116173]
Human Orthologue:
ZNF804A
Human Description:
zinc finger protein 804A [Source:HGNC Symbol;Acc:21711]
Mouse Orthologue:
Zfp804a
Mouse Description:
zinc finger protein 804A Gene [Source:MGI Symbol;Acc:MGI:2442949]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13452 Nonsense Available for shipment Available now
sa21441 Nonsense Available for shipment Available now
sa21440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 4 1132 1 4
Genomic Location (Zv9):
Chromosome 9 (position 12310407)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12062972
GRCz11 9 12034175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTCGGCTAGTGCATGGAAGCTTCGGGTCCCCCATGGCGTGTYA[T/G]TATATTGTCATCAGCTCCACGCATCTCAGCAATGGACACTTTCGAAAYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 78 1132 2 4
Genomic Location (Zv9):
Chromosome 9 (position 12199109)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11951674
GRCz11 9 11922877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGACAAACAGTATTACAAGCATCAAGAGTTTGACAACCACATCAACT[C/A]GTATGACCACGCTCACAAGCAGGTAATGGGCCTGTTGTCTGCCCCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038651 Nonsense 593 1132 4 4
Genomic Location (Zv9):
Chromosome 9 (position 12184624)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11937189
GRCz11 9 11908392
KASP Assay ID:
2260-1560.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACACTGGGAGACAGAGAGCAGTATGGTGAAATCTAAGAAATTCCTC[A/T]GACGACCTGAGTGTGTGAAAGGACTTGATAGCCAATTTAGAGGCACCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link