zgc:165543

Ensembl ID:
ENSDARG00000027065
ZFIN ID:
ZDB-GENE-070615-25
Description:
hypothetical protein LOC100073328 [Source:RefSeq peptide;Acc:NP_001092235]
Mouse Orthologue:
Slc38a3
Mouse Description:
solute carrier family 38, member 3 Gene [Source:MGI Symbol;Acc:MGI:1923507]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35132 Nonsense Available for shipment Available now
sa18531 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037017 Nonsense 31 510 1 15
ENSDART00000103157 Nonsense 31 189 2 7
ENSDART00000146944 Nonsense 31 521 2 17
Genomic Location (Zv9):
Chromosome 11 (position 35820757)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34594504
GRCz11 11 34856497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATGAAGCTGGCGAGGAGACGACTGCGACTGCAATAAAAAGCCAATCA[G/T]AAGATGCAGCTCAGTAAGTATGCGCTCAAGGGTGCACTATCTTGTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037017 Essential Splice Site 131 510 4 15
ENSDART00000103157 Essential Splice Site 131 189 5 7
ENSDART00000146944 Essential Splice Site 142 521 6 17
Genomic Location (Zv9):
Chromosome 11 (position 35804926)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34610335
GRCz11 11 34872328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTGCATACTCCATTCACCTGCTGCTAAAATCTTCAGGCGTTGTGGG[T/C]GAGTATTTTATTACATTGACCCGAAACCAATTTCTAGCTCTCCTCTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link