zgc:85777

Ensembl ID:
ENSDARG00000027009
ZFIN ID:
ZDB-GENE-040426-2210
Description:
acyl-CoA dehydrogenase-like [Source:RefSeq peptide;Acc:NP_998100]
Human Orthologues:
ACAD10, ACAD11
Human Descriptions:
acyl-CoA dehydrogenase family, member 10 [Source:HGNC Symbol;Acc:21597]
acyl-CoA dehydrogenase family, member 11 [Source:HGNC Symbol;Acc:30211]
Mouse Orthologues:
9330129D05Rik, Acad10, Acad11
Mouse Descriptions:
acyl-Coenzyme A dehydrogenase family, member 10 Gene [Source:MGI Symbol;Acc:MGI:1919235]
acyl-Coenzyme A dehydrogenase family, member 11 Gene [Source:MGI Symbol;Acc:MGI:2143169]
RIKEN cDNA 9330129D05 gene Gene [Source:MGI Symbol;Acc:MGI:2443320]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25095 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1886 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126470 Essential Splice Site 241 432 5 9
Genomic Location (Zv9):
Chromosome 19 (position 41850383)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41302637
GRCz11 19 40889757
KASP Assay ID:
554-7585.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACACAAGAACAAATCCCTGATCTGCCTGCCCATGAAACTGCCCGG[T/G]AAAACACACACAAATATTACAAAAAAAACTATTAAAAAAAATAACAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126470 Nonsense 313 432 7 9
Genomic Location (Zv9):
Chromosome 19 (position 41852861)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41305115
GRCz11 19 40892235
KASP Assay ID:
554-1876.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAAGTTTTGACGGTGATGGAGAAAGTTGTCCAGGAGACTATTCAGTA[C/A]ACCAGACAGAGGAAGATCTTCAATCAGCCCATTTTACACAATCAGGTGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link