zgc:153753

Ensembl ID:
ENSDARG00000026979
ZFIN IDs:
ZDB-GENE-060531-42, ZDB-GENE-060929-946, ZDB-GENE-060929-946
Description:
hypothetical protein LOC767716 [Source:RefSeq peptide;Acc:NP_001070122]
Human Orthologues:
AC090051.1, KRT14, KRT16, KRT18, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 18 [Source:HGNC Symbol;Acc:6430]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JEA8]
Mouse Orthologues:
Krt14, Krt16, Krt18, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 18 Gene [Source:MGI Symbol;Acc:MGI:96692]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33753 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064983 Nonsense 324 428 7 9
ENSDART00000139066 Nonsense 324 431 7 9

The following transcripts of ENSDARG00000026979 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 68448437)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64189937
GRCz11 5 64871101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGATTGGCGTTCTTGAAGGGAACCTGGAAGAGACGAATCAGAAATA[C/A]ACTCTAGAGATGGAGCGTCTTCAGAGTTCACTCACACAGCTGGAGGACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link