si:dkey-57m14.4

Ensembl ID:
ENSDARG00000026925
ZFIN IDs:
ZDB-GENE-040305-1, ZDB-GENE-040305-1, ZDB-GENE-060526-310
Description:
nitric oxide synthase 2a, inducible [Source:RefSeq peptide;Acc:NP_001098407]
Human Orthologues:
AC015688.1, NOS2
Human Description:
nitric oxide synthase 2, inducible [Source:HGNC Symbol;Acc:7873]
Mouse Orthologue:
Nos2
Mouse Description:
nitric oxide synthase 2, inducible Gene [Source:MGI Symbol;Acc:MGI:97361]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38498 Nonsense Mutation detected in F1 DNA During 2018
sa14328 Nonsense Available for shipment Available now
sa14427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019431 Nonsense 63 1079 3 25
ENSDART00000130355 Nonsense 63 1079 5 27

The following transcripts of ENSDARG00000026925 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 45402760)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43184025
GRCz11 5 43784178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATCTTTAAATTGTTTCCCCAGAATACGCCCTGCAATTCAAAAACTTG[T/A]GAGGGCTCCATTATGAATCCCAAACCTCTGATCCGCGGCCCATCCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019431 Nonsense 188 1079 5 25
ENSDART00000130355 Nonsense 188 1079 7 27
ENSDART00000019431 Nonsense 188 1079 5 25
ENSDART00000130355 Nonsense 188 1079 7 27

The following transcripts of ENSDARG00000026925 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 45404154)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43185419
GRCz11 5 43785572
KASP Assay ID:
2259-6389.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTTTMATGCCTTGTGCACTCATCTWAAGTATGCCACCAACGGAGGAAACT[T/A]GAGGTGAGGGGANTTTTTTATTTAACCCCNGTAAAACCTAAAATATCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019431 Nonsense 188 1079 5 25
ENSDART00000130355 Nonsense 188 1079 7 27
ENSDART00000019431 Nonsense 188 1079 5 25
ENSDART00000130355 Nonsense 188 1079 7 27

The following transcripts of ENSDARG00000026925 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 45404154)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43185419
GRCz11 5 43785572
KASP Assay ID:
2259-6389.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTTTMATGCCTTGTGCACTCATCTWAAGTATGCCACCAACGGAGGAAACT[T/A]GAGGTGAGGGGANTTTTTTATTTAACCCCNGTAAAACCTAAAATATCAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link