zgc:77727

Ensembl ID:
ENSDARG00000026895
ZFIN ID:
ZDB-GENE-040426-1859
Description:
torsin A [Source:RefSeq peptide;Acc:NP_957150]
Human Orthologues:
TOR1A, TOR1B
Human Descriptions:
torsin family 1, member A (torsin A) [Source:HGNC Symbol;Acc:3098]
torsin family 1, member B (torsin B) [Source:HGNC Symbol;Acc:11995]
Mouse Orthologues:
Tor1a, Tor1b
Mouse Descriptions:
torsin family 1, member A (torsin A) Gene [Source:MGI Symbol;Acc:MGI:1353568]
torsin family 1, member B Gene [Source:MGI Symbol;Acc:MGI:1353605]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7254 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031875 Nonsense 288 328 5 5
Genomic Location (Zv9):
Chromosome 23 (position 37664550)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37463778
GRCz11 23 37566440
KASP Assay ID:
554-5266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTGCRSCAGTGTGTCTTGGCTGAGATGTATTATCTGAACAAAACCY[T/A]AGATGCTCATCTGGCAGATAAAGTGGCCCGAGACATGCCTTTCTTYCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link