zgc:73225

Ensembl ID:
ENSDARG00000026875
ZFIN IDs:
ZDB-GENE-030131-2046, ZDB-GENE-030131-2046
Description:
hypothetical protein LOC323326 [Source:RefSeq peptide;Acc:NP_955931]
Human Orthologue:
FAM57B
Human Description:
family with sequence similarity 57, member B [Source:HGNC Symbol;Acc:25295]
Mouse Orthologue:
Fam57b
Mouse Description:
family with sequence similarity 57, member B Gene [Source:MGI Symbol;Acc:MGI:1916202]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2099 Nonsense F2 line generated During 2018
sa40047 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2099
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036741 Nonsense 27 242 4 7
ENSDART00000111731 Nonsense 77 292 3 6
Genomic Location (Zv9):
Chromosome 3 (position 21140439)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20900176
GRCz11 3 21049916
KASP Assay ID:
554-2742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTTTTTCTCTTCCATTTTCCTTCCAGGCATTGGCTCACCACCAGCTA[T/G]ATCCTCTTTGCAGTCCCCTACTTCGTTTATGACATCTATGCCATGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036741 Essential Splice Site 126 242 5 7
ENSDART00000111731 Essential Splice Site 176 292 4 6
Genomic Location (Zv9):
Chromosome 3 (position 21138297)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20898034
GRCz11 3 21047774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAGAACTCAGCACCCCGTCTGTCTGTCTGGGAAAAATACTCATCCAG[G/T]TACTAAACACAAACATTCTCCTCCATCTTCCTGTGTTTTTCTTTCATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link