uchl1

Ensembl ID:
ENSDARG00000026871
ZFIN ID:
ZDB-GENE-030131-3844
Description:
ubiquitin carboxyl-terminal hydrolase isozyme L1 [Source:RefSeq peptide;Acc:NP_958885]
Human Orthologue:
UCHL1
Human Description:
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) [Source:HGNC Symbol;Acc:12513]
Mouse Orthologue:
Uchl1
Mouse Description:
ubiquitin carboxy-terminal hydrolase L1 Gene [Source:MGI Symbol;Acc:MGI:103149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38261 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036797 Nonsense 132 218 5 9
ENSDART00000122309   None 27 None 1
Genomic Location (Zv9):
Chromosome 1 (position 21423120)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21958287
GRCz11 1 22649026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTCAGGGATGTCTCCTGCAGAACGAGCCAAAGAACTTGAACAAAAT[A/T]AGGTATTTATTAATGTCAAGCCACACAAAGCATGTGATTTCCCACATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link