si:dkey-24h18.1

Ensembl ID:
ENSDARG00000026840
ZFIN ID:
ZDB-GENE-081031-78
Description:
Novel protein similar to H.sapien ARHGAP23, Rho GTPase activating protein 23 (ARHGAP23) [Source:UniP
Human Orthologues:
AC140658.1, AC142086.3, AC142381.2, ARHGAP23
Human Descriptions:
Rho GTPase activating protein 23 [Source:HGNC Symbol;Acc:29293]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MTI0]
Mouse Orthologue:
Arhgap23
Mouse Description:
Rho GTPase activating protein 23 Gene [Source:MGI Symbol;Acc:MGI:3697726]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8693 Nonsense Mutation detected in F1 DNA During 2018
sa41991 Nonsense Mutation detected in F1 DNA During 2018
sa22059 Essential Splice Site Available for shipment Available now
sa8674 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa30957 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029572 Nonsense 241 1087 6 30
ENSDART00000147422   None 376 None 9
Genomic Location (Zv9):
Chromosome 12 (position 16381050)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15492015
GRCz11 12 15534322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCCTAGGAAAGCCAGTCTTCCCCAAGGTCRCAGYGAACTGTGCCAC[C/T]AAGGTCTGTCAGACTGGTACTATAGCCAAGTAGACCAATCAAGCCTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029572 Nonsense 336 1087 6 30
ENSDART00000147422   None 376 None 9
Genomic Location (Zv9):
Chromosome 12 (position 16381335)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15492300
GRCz11 12 15534607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTAGCCATTCCTGTTCTGAAAACTTGCTAGCTGCTTATGCTTCGTAC[G/T]AGCAGAGCTTTGGTCATTCACTGGAAACTCTAGAAAAGGCATCCATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029572 Essential Splice Site 500 1087 13 30
ENSDART00000147422   None 376 None 9
Genomic Location (Zv9):
Chromosome 12 (position 16391108)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15502073
GRCz11 12 15544380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGCCTTTAAATTGCACTTTAAGCTGAATACTAGTATCTTGAAAAACA[T/A]ACAAAGTATATAGGGGGCTAATAATCCAACAGGGCTAATAATTCTGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029572 Essential Splice Site 758 1087 19 30
ENSDART00000147422 Missense 158 376 3 9
Genomic Location (Zv9):
Chromosome 12 (position 16396198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15507163
GRCz11 12 15549470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAATGATGCCACCTTTCTTTCTCTCTAAAACTGAAAAYGCATCTGCT[G/A]TAAGCAAAGCCCCAGGAAAAGGTGAACGACMTACAGGCTTTGATGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029572 Essential Splice Site 909 1087 23 30
ENSDART00000147422 Essential Splice Site 304 376 7 9
Genomic Location (Zv9):
Chromosome 12 (position 16397236)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15508201
GRCz11 12 15550508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCGTTTAGAGGATACAGGGGATCGCTTGAAGACCATGAGGAAACTTG[T/C]ATGTACCGTCATACGCTAAATACAGTTTATTTTGTGATAACTTTAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link