Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
med21
- Ensembl ID:
- ENSDARG00000026839
- ZFIN ID:
- ZDB-GENE-040426-2763
- Description:
- Mediator of RNA polymerase II transcription subunit 21 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTI5]
- Human Orthologue:
- MED21
- Human Description:
- mediator complex subunit 21 [Source:HGNC Symbol;Acc:11473]
- Mouse Orthologue:
- Med21
- Mouse Description:
- mediator complex subunit 21 Gene [Source:MGI Symbol;Acc:MGI:1347064]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20175 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20175
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000032460 | Nonsense | 28 | 145 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 1617281)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 1908913 GRCz11 4 1758226 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGTGTTTCAGCTGGCGGATCAGTTCTGTAATGCGATTGGAGTTCTGCAG[C/T]AGTGCGCACCACCGGCCTCCTTCAGCAACATCCAGACGGCCATCAATAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
