zgc:77462

Ensembl ID:
ENSDARG00000026834
ZFIN ID:
ZDB-GENE-030131-8171
Description:
Cerebellar degeneration-related protein 2-like [Source:UniProtKB/Swiss-Prot;Acc:Q6NZT2]
Human Orthologue:
CDR2L
Human Description:
cerebellar degeneration-related protein 2-like [Source:HGNC Symbol;Acc:29999]
Mouse Orthologue:
Cdr2l
Mouse Description:
cerebellar degeneration-related protein 2-like Gene [Source:MGI Symbol;Acc:MGI:2684867]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6924 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035878 Nonsense 248 458 5 5
ENSDART00000124038 Nonsense 254 464 6 6
ENSDART00000128790 Nonsense 254 468 5 6
ENSDART00000147784   None 26 None 1
Genomic Location (Zv9):
Chromosome 3 (position 60358587)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59661046
GRCz11 3 59952147
KASP Assay ID:
554-4871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGGCTGAGAGCTGTCAGCGGCGCGTGCACGAGCTGGAGGCAGAGCTT[C/T]AGGAGATGCAGCAGCTCCGCAAGTCTCGCGTATGTCTGCTGAGCGGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link