cotl1

Ensembl ID:
ENSDARG00000026829
ZFIN ID:
ZDB-GENE-030131-8325
Description:
coactosin-like protein [Source:RefSeq peptide;Acc:NP_956306]
Human Orthologue:
COTL1
Human Description:
coactosin-like 1 (Dictyostelium) [Source:HGNC Symbol;Acc:18304]
Mouse Orthologue:
Cotl1
Mouse Description:
coactosin-like 1 (Dictyostelium) Gene [Source:MGI Symbol;Acc:MGI:1919292]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39194 Nonsense Mutation detected in F1 DNA During 2018
sa45633 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43066 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032151 Nonsense 4 142 1 4
Genomic Location (Zv9):
Chromosome 18 (position 12680773)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13235585
GRCz11 18 13204097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGCATTTAGACACATTATCTCCCTTTGCATCGTCGAAATGGCAACA[C/T]GAATTGACAAAGAGGCTTGCAGAGAGGCATACAATCTGGTGCGAGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032151 Essential Splice Site 26 142 2 4
Genomic Location (Zv9):
Chromosome 18 (position 12681138)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13235950
GRCz11 18 13204462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTATAATAATTGTGTCCACTGTTAATAATGTCATATTTGATGTTTAA[A/C]GGGCATGTTTTAAGTATGACGGATCTACAATTGTACCAGGCGGGCATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032151 Nonsense 137 142 4 4
Genomic Location (Zv9):
Chromosome 18 (position 12692618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13247430
GRCz11 18 13215942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGAATACCTACGTACTGAGCTCAAGAAAGCTGGCGGCGCCAACTA[T/A]GATGCCCAGGCTGAATAAAACTTGGGGATGGGTTTCCACTGGGTTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link