suv39h1a

Ensembl ID:
ENSDARG00000026799
ZFIN ID:
ZDB-GENE-040801-111
Description:
Histone-lysine N-methyltransferase SUV39H1-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DGD3]
Human Orthologue:
SUV39H2
Human Description:
suppressor of variegation 3-9 homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17287]
Mouse Orthologue:
Suv39h2
Mouse Description:
suppressor of variegation 3-9 homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16242 Nonsense Available for shipment Available now
sa44685 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038955 Nonsense 22 411 2 6
Genomic Location (Zv9):
Chromosome 8 (position 24248709)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23374527
GRCz11 8 23395766
KASP Assay ID:
2260-0539.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGATTGCAGGGTGCCYTGTAARCTTTTGTTGGAGGACMTTCAGGCTT[T/A]GTGCCGAAGAAAAAAACTAGTTTGCAAGCAGCTGAGTGTGACAAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038955 Nonsense 67 411 3 6
Genomic Location (Zv9):
Chromosome 8 (position 24250284)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23376102
GRCz11 8 23397341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGCCTGTTCAGGGTCGAGAGTTCTTCCTGGTGAAGTGGAAAGGCTA[C/G]GAGGAGTCAGAAAACACCTGGGAGCCTCTTAAAAACCTTAAATGCCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link