zgc:109901

Ensembl ID:
ENSDARG00000026767
ZFIN ID:
ZDB-GENE-030131-419
Description:
Nucleolar protein 11-like [Source:UniProtKB/Swiss-Prot;Acc:Q4V9P9]
Human Orthologue:
NOL11
Human Description:
nucleolar protein 11 [Source:HGNC Symbol;Acc:24557]
Mouse Orthologue:
Nol11
Mouse Description:
nucleolar protein 11 Gene [Source:MGI Symbol;Acc:MGI:1916229]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17711 Nonsense Available for shipment Available now
sa30872 Nonsense Mutation detected in F1 DNA During 2018
sa40674 Nonsense Mutation detected in F1 DNA During 2018
sa33853 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33852 Nonsense Mutation detected in F1 DNA During 2018
sa26731 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 80 708 2 18
Genomic Location (Zv9):
Chromosome 6 (position 21587637)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17903411
GRCz11 6 23001330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGTTGATCACCTGYCCCGCTGTGTATAACACAAAGTCCCAGGAATA[T/A]GTGGYTGTTACAGATAATAAGGTAAGGTGATATAATATTTTATATTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 125 708 4 18
ENSDART00000037709 Nonsense 125 708 4 18
Genomic Location (Zv9):
Chromosome 6 (position 21584931)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17900705
GRCz11 6 22998624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 125 708 4 18
ENSDART00000037709 Nonsense 125 708 4 18
Genomic Location (Zv9):
Chromosome 6 (position 21584931)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17900705
GRCz11 6 22998624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGATGTTCTCAGGGTGATGGCAGCTTCTGACTCTGAACCTGTTGTGT[T/A]GTTTAGTTGTGGGGCTGTCATGTTCTTGGACTCGTTGCTTGCTTCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Essential Splice Site 291 708 8 18
Genomic Location (Zv9):
Chromosome 6 (position 21572997)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17888771
GRCz11 6 22986690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCACCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGC[A/T]GATTATCTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Nonsense 292 708 8 18
Genomic Location (Zv9):
Chromosome 6 (position 21572991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17888765
GRCz11 6 22986684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGGCTTTTGGTGCGATGATCATTATGATGTTGTCATTTGCAGATTA[T/G]CTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGGCTTGTAAAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037709 Essential Splice Site 512 708 13 18
Genomic Location (Zv9):
Chromosome 6 (position 21566179)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17881953
GRCz11 6 22979872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACATTCCTGAAGCTGTTACCTGTGCTTATCTCAAAACCATTTTGAGG[T/C]GAGTCTTCAACTAACTTTTTGTTAACATTTGTTACATTTAAAAATTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link