zgc:77228

Ensembl ID:
ENSDARG00000026762
ZFIN ID:
ZDB-GENE-040426-1806
Description:
Hyccin [Source:UniProtKB/Swiss-Prot;Acc:Q6P121]
Human Orthologue:
FAM126A
Human Description:
family with sequence similarity 126, member A [Source:HGNC Symbol;Acc:24587]
Mouse Orthologue:
Fam126a
Mouse Description:
family with sequence similarity 126, member A Gene [Source:MGI Symbol;Acc:MGI:2149839]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15394 Essential Splice Site Available for shipment Available now
sa8406 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033132 Essential Splice Site 111 518 4 11
Genomic Location (Zv9):
Chromosome 19 (position 3062743)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2708721
GRCz11 19 2639605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGCAGCGGCTGCATAGAGGCGCTACTTCTCGGCATCTACAACCTGG[T/C]CAGTGCCTCTYYACATTACATTAGACATGGGCTGGTATAAYATTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033132 Nonsense 413 518 11 11
Genomic Location (Zv9):
Chromosome 19 (position 3086787)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2732765
GRCz11 19 2663649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGATAARGAGAAGGACGCGGCCACCGGCATGGACCAGYTAACCCGC[A/T]AACAAGCAGCCGTCCGCGCCATGAGTGAAAACCTAGAGCTGCTGTCACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link