il11ra

Ensembl ID:
ENSDARG00000026736
ZFIN ID:
ZDB-GENE-030131-5942
Description:
interleukin 11 receptor, alpha [Source:RefSeq peptide;Acc:NP_001106971]
Human Orthologue:
IL11RA
Human Description:
interleukin 11 receptor, alpha [Source:HGNC Symbol;Acc:5967]
Mouse Orthologues:
Gm13305, Gm2002, Il11ra1, Il11ra2
Mouse Descriptions:
interleukin 11 receptor, alpha chain 1 Gene [Source:MGI Symbol;Acc:MGI:107426]
interleukin 11 receptor, alpha chain 2 Gene [Source:MGI Symbol;Acc:MGI:109123]
predicted gene 13305 Gene [Source:MGI Symbol;Acc:MGI:3801997]
predicted gene 2002 Gene [Source:MGI Symbol;Acc:MGI:3780172]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45398 Nonsense Mutation detected in F1 DNA During 2018
sa12313 Nonsense Available for shipment Available now
sa34862 Nonsense Available for shipment Available now
sa45397 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030976 Nonsense 132 402 4 10
ENSDART00000135941 Nonsense 132 402 4 11
Genomic Location (Zv9):
Chromosome 10 (position 13295875)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13373966
GRCz11 10 13332085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTCTTGTCGTGTGCCGAATCATATGAAAATCTCCTGCTCCTGGGAA[C/T]AAACCAAGAGGACAAACTTGCCCACATCATACAGAGCCTCATACAGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030976 Nonsense 161 402 5 10
ENSDART00000135941 Nonsense 161 402 5 11
Genomic Location (Zv9):
Chromosome 10 (position 13294272)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13372363
GRCz11 10 13330482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATACAGTCAGAAGGGCCAGGGCCGCAAGCAAATTCCCAGTGAACCCTG[T/A]GAACAGAAGGATWCCGGGGTAAATGAGTGYACAATTAMAGACCCACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030976 Nonsense 239 402 6 10
ENSDART00000135941 Nonsense 239 402 6 11
Genomic Location (Zv9):
Chromosome 10 (position 13290529)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13368620
GRCz11 10 13326739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGTGAGCCTACACAGTTACTGGTCCAGTGGAACTGTCCCCCATCAT[G/A]GCTGGTTGGCATGTCTGCTTTTTCATTGACATATTTACTGCGCTACCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030976 Nonsense 389 402 10 10
ENSDART00000135941 Nonsense 389 402 10 11
Genomic Location (Zv9):
Chromosome 10 (position 13279483)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13357574
GRCz11 10 13315693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATTCTCCTCACAGGGTGAGACAAAGGAAACAAGACAATGTGAAGAAA[C/T]AAGAACTGACTTCTATGCTGAAGATGAAGTCCATACCAATCTAAAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link