anxa1a

Ensembl ID:
ENSDARG00000026726
ZFIN ID:
ZDB-GENE-030131-6664
Description:
annexin A1 [Source:RefSeq peptide;Acc:NP_861423]
Human Orthologue:
ANXA1
Human Description:
annexin A1 [Source:HGNC Symbol;Acc:533]
Mouse Orthologue:
Anxa1
Mouse Description:
annexin A1 Gene [Source:MGI Symbol;Acc:MGI:96819]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33598 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031665 Essential Splice Site None 340 1 13
ENSDART00000123986   None 340 None 12
ENSDART00000145353   None 230 None 9

The following transcripts of ENSDARG00000026726 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27227648)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24982946
GRCz11 5 25583099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGCTCAAATCTTTTCTCCTCCTCGCTTGCTGTGCATTCGCTCTTGG[T/C]AAGTGGGGATTATCTATATTTCTTACCCTTCATTTAATAGCCAGTGTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link