syncripl

Ensembl ID:
ENSDARG00000026723
ZFIN ID:
ZDB-GENE-030131-3104
Description:
synaptotagmin binding, cytoplasmic RNA interacting protein, like [Source:RefSeq peptide;Acc:NP_9559
Human Orthologue:
SYNCRIP
Human Description:
synaptotagmin binding, cytoplasmic RNA interacting protein [Source:HGNC Symbol;Acc:16918]
Mouse Orthologue:
Syncrip
Mouse Description:
synaptotagmin binding, cytoplasmic RNA interacting protein Gene [Source:MGI Symbol;Acc:MGI:1891690]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23192 Essential Splice Site Available for shipment Available now
sa15108 Nonsense Available for shipment Available now
sa23193 Essential Splice Site Available for shipment Available now
sa32175 Nonsense Available for shipment Available now
sa44878 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037450 Essential Splice Site 126 558 4 13
Genomic Location (Zv9):
Chromosome 17 (position 50802902)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50193719
GRCz11 17 50272788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAAAGTGTCAGACTCTACTAAAGGACCAGACGAGGCCAAAATCAAAG[T/G]CAGTCTGCTTCACTTCTCTACTGTCTGTTCTGTCCAGCCGCTGTTGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037450 Nonsense 158 558 5 13
Genomic Location (Zv9):
Chromosome 17 (position 50803106)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50193923
GRCz11 17 50272992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCGCAAATATGGTGGWCCGCCTCCAGGATCGACCCATGCCGGAGTR[C/T]AGCCCACCATCGGCACAGAGGTCAGTCTYGGAGTCTAATAGATTSWCAWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037450 Essential Splice Site 223 558 6 13
Genomic Location (Zv9):
Chromosome 17 (position 50805206)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50196023
GRCz11 17 50275092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCGTCACCTTCTGCACTAAAGAGGCTGCTCAAAAAGCGGTCAAGCTG[G/A]TAAGTGCTGATCTGTTAGTCCTCGCGCAGCTTGCTGGAGTCAGGGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037450 Nonsense 417 558 10 13
Genomic Location (Zv9):
Chromosome 17 (position 50808449)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50199266
GRCz11 17 50278335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAATTGAAATCGTCTTCGCAAAGCCGCCCGATCAGAAGAGGAAAGAG[C/T]GAAAGGCCCAGAGACAAGCTGCTAAAACTCAAATGTAAGAGCATTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037450 Missense 460 558 12 13
Genomic Location (Zv9):
Chromosome 17 (position 50808739)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50199556
GRCz11 17 50278625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGAGCGAGGGGACGAGGTGCTAGAGGTTATTCGTATCCGCATGACTA[T/G]TACAGCTATGAGGATTATTACAACTACTATGGCTACGACTATCACAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link