rab5c

Ensembl ID:
ENSDARG00000026712
ZFIN ID:
ZDB-GENE-031118-30
Description:
ras-related protein Rab-5C [Source:RefSeq peptide;Acc:NP_958909]
Human Orthologue:
RAB5C
Human Description:
RAB5C, member RAS oncogene family [Source:HGNC Symbol;Acc:9785]
Mouse Orthologue:
Rab5c
Mouse Description:
RAB5C, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44559 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034536 Essential Splice Site 148 221 4 6
Genomic Location (Zv9):
Chromosome 3 (position 17291219)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17497552
GRCz11 3 17647352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGCAACAAAGCAGATCTGGCCAACAAGAGAGCCGTTGACTTTCAGG[T/C]AAACTTTTAAAACCAAACCGACCTGTATGGCTTCTAAAATTATTATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link