zgc:92126

Ensembl ID:
ENSDARG00000026701
ZFIN ID:
ZDB-GENE-040912-164
Description:
general transcription factor IIH subunit 1 [Source:RefSeq peptide;Acc:NP_001004596]
Human Orthologue:
GTF2H1
Human Description:
general transcription factor IIH, polypeptide 1, 62kDa [Source:HGNC Symbol;Acc:4655]
Mouse Orthologue:
Gtf2h1
Mouse Description:
general transcription factor II H, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1277216]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6789 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10259 Nonsense Available for shipment Available now
sa13977 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032390 Essential Splice Site 354 550 10 15
Genomic Location (Zv9):
Chromosome 25 (position 3169628)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3077187
GRCz11 25 3202931
KASP Assay ID:
554-5480.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGAAAATCCTGTTGTCGTTTATTTTTCTAATGTTGTGTTTGTGGCTCSTC[A/C]GGKRAAATTACAGGAAGCCATAGAGTATGATGACCTGCAAAACGACTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032390 Nonsense 516 550 14 15
Genomic Location (Zv9):
Chromosome 25 (position 3165127)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3072686
GRCz11 25 3198430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAGGTTTCAGGTGACCAAGCTCCGCCCCTTTCAAGAGAAGATCCAG[C/T]GACAGTATTTGAGCACTAATGTAAGGYCACGCCCCCCNNNNNNGNACCACAMCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032390 Essential Splice Site 522 550 14 15
Genomic Location (Zv9):
Chromosome 25 (position 3165105)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3072664
GRCz11 25 3198408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCGCCCCTTTCAAGAGAAGATCCAGYGACAGTATTTGAGCACTAATG[T/A]AAGGYCACGCCCCCCNNNNNNGNACCACAMCCCCTCTGCTATCTGTAATGGATTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyloid A Levels: Genome-wide association study identifies two novel regions at 11p15.5-p13 and 1p31 with major impact on acute-phase serum amyloid A. (View Study)
  • Pancreatic cancer: Genome-wide association study of survival in patients with pancreatic adenocarcinoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link