zgc:101583

Ensembl ID:
ENSDARG00000026682
ZFIN ID:
ZDB-GENE-041212-75
Description:
hypothetical protein LOC494104 [Source:RefSeq peptide;Acc:NP_001008647]
Human Orthologue:
NIPA2
Human Description:
non imprinted in Prader-Willi/Angelman syndrome 2 [Source:HGNC Symbol;Acc:17044]
Mouse Orthologue:
Nipa2
Mouse Description:
non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22529 Essential Splice Site Available for shipment Available now
sa45522 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22528 Essential Splice Site Available for shipment Available now
sa35740 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035779 Essential Splice Site 1 358 None 6
ENSDART00000126334   1 358 None 5
Genomic Location (Zv9):
Chromosome 14 (position 40385765)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38548999
GRCz11 14 38889313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCGATATAACTTTAATATCTTACGGGATTTTATTCTAACTGCATTT[A/G]GATGGATGTTGCAAACCGCTCGGACTTTTACATTGGTCTGGCGCTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035779 Essential Splice Site 45 358 2 6
ENSDART00000126334 Essential Splice Site 45 358 1 5
Genomic Location (Zv9):
Chromosome 14 (position 40385627)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38548861
GRCz11 14 38889175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAGAAGGGGCTCCTACGTCTGGCATCAAAGGGGTCCACTAGAGCAG[G/A]TGGGTAAAATGCATGTTTCCCTTACATATACAATACTCTTGTATATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035779 Essential Splice Site 149 358 5 6
ENSDART00000126334 Essential Splice Site 149 358 4 5
Genomic Location (Zv9):
Chromosome 14 (position 40384527)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38547761
GRCz11 14 38888075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGTTGCTTCTTTATCTGCAATGGCAGAGAAACTCAAAGATCCAGG[T/C]AATGTTCAGTTGAATGTAACCCTTTACAGTGCAGCATGTATAAGTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035779 Nonsense 234 358 6 6
ENSDART00000126334 Nonsense 234 358 5 5
Genomic Location (Zv9):
Chromosome 14 (position 40382528)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38545762
GRCz11 14 38886076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCTTTGCTCATATGCCTCGTGGTCTGCATCAGCATCCAGATCAGCTA[T/A]CTAAATAAAGCCTTGGACATCTTTAACACCTCGATAGTCACACCTATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link