zgc:153725

Ensembl ID:
ENSDARG00000026630
ZFIN IDs:
ZDB-GENE-060929-80, ZDB-GENE-060929-80
Description:
MAP/microtubule affinity-regulating kinase 3 [Source:RefSeq peptide;Acc:NP_001070043]
Human Orthologue:
MARK3
Human Description:
MAP/microtubule affinity-regulating kinase 3 [Source:HGNC Symbol;Acc:6897]
Mouse Orthologue:
Mark3
Mouse Description:
MAP/microtubule affinity-regulating kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1341865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43522 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026213   None 745 None 17
ENSDART00000087214 Essential Splice Site 625 754 16 18
Genomic Location (Zv9):
Chromosome 20 (position 43835021)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43906180
GRCz11 20 43803258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTTCTGTTTCTTTTGTAGAAATATGTCATTCAGGTTTTCTAAAAG[G/A]TAGGACCCTCGACGGGCTGTGTGCAGTTATCTAGCACCCAAATATGCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link