zgc:113425

Ensembl ID:
ENSDARG00000026616
ZFIN ID:
ZDB-GENE-050320-128
Description:
hypothetical protein LOC541425 [Source:RefSeq peptide;Acc:NP_001013570]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22547 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031640 Essential Splice Site 119 223 4 7
ENSDART00000132966 Essential Splice Site 119 223 4 7
Genomic Location (Zv9):
Chromosome 14 (position 49130346)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47208005
GRCz11 14 46195297
KASP Assay ID:
2260-7913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGAGGAGGATGATGAGATCTTCCACGCCCATCCGGTTCCTGAAGTG[G/T]TACAGTTCGAACACTGGATCATCTGTTATATGCTCACTGTAACAGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link