zgc:110331

Ensembl ID:
ENSDARG00000026582
ZFIN ID:
ZDB-GENE-050417-332
Description:
nitrogen fixation cluster-like [Source:RefSeq peptide;Acc:NP_001017800]
Human Orthologue:
ISCU
Human Description:
iron-sulfur cluster scaffold homolog (E. coli) [Source:HGNC Symbol;Acc:29882]
Mouse Orthologue:
Iscu
Mouse Description:
IscU iron-sulfur cluster scaffold homolog (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1913633]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17459 Nonsense Available for shipment Available now
sa31453 Essential Splice Site Available for shipment Available now
sa31454 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036235 Nonsense 102 164 3 5
ENSDART00000140541 Nonsense 64 126 2 4

The following transcripts of ENSDARG00000026582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33505448)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31267680
GRCz11 5 31867833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTGGCTGTGGCTCTGCTATTGCTTCCAGCTCTTTGGCTACCGAGTG[G/A]GTGAAAGGCAAATCTGTAAGCAGAAATGCCATTTTTATTAGTTCTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036235 Essential Splice Site 107 164 3 5
ENSDART00000140541 Essential Splice Site 69 126 2 4

The following transcripts of ENSDARG00000026582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33505464)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31267696
GRCz11 5 31867849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTATTGCTTCCAGCTCTTTGGCTACCGAGTGGGTGAAAGGCAAATCT[G/A]TAAGCAGAAATGCCATTTTTATTAGTTCTTTGGATGTTTTCCTGTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036235 Nonsense 147 164 5 5
ENSDART00000140541 Nonsense 109 126 4 4

The following transcripts of ENSDARG00000026582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33505865)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31268097
GRCz11 5 31868250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATGCAGTGCTGGCAGAGGATGCTATTAAAGCAGCTTTGGCCGACTA[C/A]CGCCTGAAACAGGAAGGTGAACCGGTTGAGGAGACAGCTGTGGCCCGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link