
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ralgps2
- Ensembl ID:
- ENSDARG00000026519
- ZFIN ID:
- ZDB-GENE-040426-1212
- Description:
- Ral-A exchange factor RalGPS2 [Source:RefSeq peptide;Acc:NP_956768]
- Human Orthologue:
- RALGPS2
- Human Description:
- Ral GEF with PH domain and SH3 binding motif 2 [Source:HGNC Symbol;Acc:30279]
- Mouse Orthologue:
- Ralgps2
- Mouse Description:
- Ral GEF with PH domain and SH3 binding motif 2 Gene [Source:MGI Symbol;Acc:MGI:1925505]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11383 | Nonsense | Available for shipment | Available now |
sa43404 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43403 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11383
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021550 | Nonsense | 124 | 586 | 7 | 21 |
ENSDART00000037420 | None | 564 | None | 20 | |
ENSDART00000127622 | Nonsense | 132 | 594 | 5 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 16075313)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 16135266 GRCz11 20 16034849 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTCTTCATGCTCAGACTCTRAAGATCAGAGCAGAAGTKTTGAGCCTCTA[T/A]ATCAGAACAGYAAAGGTAAAAAMACAAAAGTCAGAATGCATACTGTGAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43404
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021550 | Essential Splice Site | 203 | 586 | 9 | 21 |
ENSDART00000037420 | Essential Splice Site | 181 | 564 | 8 | 20 |
ENSDART00000127622 | Essential Splice Site | 211 | 594 | 7 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 16061092)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 16121045 GRCz11 20 16020628 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGATTACATCAGCAGCCAGAGCATGACATCCTGCATCCCGTATCTGGG[T/A]ATTTCTCCTGCTTTCTCTTCCGCACACATTCAGTCACAACCTTATAGGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43403
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021550 | Nonsense | 216 | 586 | 10 | 21 |
ENSDART00000037420 | Nonsense | 194 | 564 | 9 | 20 |
ENSDART00000127622 | Nonsense | 224 | 594 | 8 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 16015545)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 16075498 GRCz11 20 15975081 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTTGCAGGAATCTATTTGTCTGATCTGACGTACATTGATTCGGCGTA[T/G]CCCTCCACTGGAAGCATCCTTGAAAACGAACAGCGCTCCAACCTCATGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: