zgc:163038

Ensembl ID:
ENSDARG00000026489
ZFIN ID:
ZDB-GENE-030131-4357
Description:
far upstream element-binding protein 2 [Source:RefSeq peptide;Acc:NP_001082897]
Human Orthologue:
KHSRP
Human Description:
KH-type splicing regulatory protein [Source:HGNC Symbol;Acc:6316]
Mouse Orthologue:
Khsrp
Mouse Description:
KH-type splicing regulatory protein Gene [Source:MGI Symbol;Acc:MGI:1336214]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6606 Nonsense Mutation detected in F1 DNA During 2018
sa39709 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038330 Nonsense 278 666 10 18
ENSDART00000140016   None 136 None 7
Genomic Location (Zv9):
Chromosome 1 (position 55505382)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54288321
GRCz11 1 54965972
KASP Assay ID:
554-4101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCGAGAGCGGGATCATCCGGGCTTYGAGAGGAATGAGTATGGCTCT[C/T]GAATGGGTGGTGGAGGAGGTGGAGGCGGCGGTGGTGGAGGTGGCGGCGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038330 Essential Splice Site 474 666 13 18
ENSDART00000140016   None 136 None 7
Genomic Location (Zv9):
Chromosome 1 (position 55503997)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54286936
GRCz11 1 54964587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACAGCAGATCGACCACGCCAAACAGCTGATCGAGGACAAGATTGAGG[T/C]GCGCTGAGCATTGCCTTTTTGTTTATTTTATCTTGACATTGGTGTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038330 Nonsense 555 666 16 18
ENSDART00000140016   None 136 None 7
Genomic Location (Zv9):
Chromosome 1 (position 55502786)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54285725
GRCz11 1 54963376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCACAGATCCAAACGCAGCGTGGGCGGCTTATTACGCTCAGTACTAC[C/T]AGCAGCCAGGAGGGGCAGCTATGCCTGGACAGACGCCTGCAGCTCAGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link