six1b

Ensembl ID:
ENSDARG00000026473
ZFIN ID:
ZDB-GENE-040426-2308
Description:
homeobox protein SIX1 [Source:RefSeq peptide;Acc:NP_996978]
Human Orthologue:
SIX1
Human Description:
SIX homeobox 1 [Source:HGNC Symbol;Acc:10887]
Mouse Orthologue:
Six1
Mouse Description:
sine oculis-related homeobox 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10473 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036124 Nonsense 171 284 1 2
Genomic Location (Zv9):
Chromosome 20 (position 20572740)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20600907
GRCz11 20 20500580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAGCTGGCCGAGGCCACAGGACTGACTACCACACAAGTGAGCAACTG[G/A]TTTAAAAACAGACGGCAGAGGGATCGCGCAGCGGAGGCGAAAGAAAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link