zgc:66474

Ensembl ID:
ENSDARG00000026453
ZFIN ID:
ZDB-GENE-030131-5711
Description:
hypothetical protein LOC327500 [Source:RefSeq peptide;Acc:NP_956109]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40022 Nonsense Mutation detected in F1 DNA During 2018
sa40021 Nonsense Mutation detected in F1 DNA During 2018
sa26018 Nonsense Mutation detected in F1 DNA During 2018
sa26017 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026658   None 1026 None 8
ENSDART00000115022 Nonsense 418 464 4 4
ENSDART00000126913   None 1026 None 14

The following transcripts of ENSDARG00000026453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15260429)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15506035
GRCz11 3 15655835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTTAGAATAAAACACCAGCATGCTTACGTGGAAGCAAAAGGTTAC[C/T]GACCGGTCAATATGCGGATCGACACTTTGGACACCGTTCCAATTAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026658 Nonsense 523 1026 6 8
ENSDART00000115022   None 464 None 4
ENSDART00000126913 Nonsense 523 1026 6 14

The following transcripts of ENSDARG00000026453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15253658)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15499264
GRCz11 3 15649064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGTGAAACGGGAAACGATGGAATCACAAAAGGTCTTAACCAAGGCA[C/T]AGGCAATCACTGAAGAGACAAAAGGTGAAACAGAAGCATCAAAGGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026658 Nonsense 629 1026 6 8
ENSDART00000115022   None 464 None 4
ENSDART00000126913 Nonsense 629 1026 6 14

The following transcripts of ENSDARG00000026453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15253340)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15498946
GRCz11 3 15648746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGAAACACATCGCAGCTAACTTGCAGGTTTTAAGAAAAAGGAAAAGG[G/T]AAGCAAGAAGATTGGAAGAAGAGCAAGAAGAAAAGAGATTGAAGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026658 Nonsense 916 1026 8 8
ENSDART00000115022   None 464 None 4
ENSDART00000126913 Nonsense 916 1026 8 14

The following transcripts of ENSDARG00000026453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15251887)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15497493
GRCz11 3 15647293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTAGTCCTGGGAACGTAGAGGTCTCTGTGCTGGCTAGTTCTCAAT[C/A]GAAAGTAAAGCTTGACAACTCTGGGGGCTCAGCGGCCATTCAAGAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link