
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ccr12.2
- Ensembl ID:
- ENSDARG00000026417
- ZFIN ID:
- ZDB-GENE-070301-2
- Description:
- Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRY7]
- Human Orthologue:
- XCR1
- Human Description:
- chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
- Mouse Orthologue:
- Xcr1
- Mouse Description:
- chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18480 | Nonsense | Available for shipment | Available now |
sa12285 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18480
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066872 | Nonsense | 179 | 346 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 24 (position 595721)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 535693 GRCz11 24 265352 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCRTCTACGCTGCATCGTTATCTGTGGCYGTCTGGATTWTCAGCCTTCTC[G/T]MAAGCCTCGAATATCTCATCCGTTTCACAGTGGAAGAGTCTCAGATGGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12285
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066872 | Nonsense | 229 | 346 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 24 (position 595873)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 535845 GRCz11 24 265504 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACAAGCAGTTTGTGTTGTTCTTCCTCTTCCCGCTGGTTGTGTTTGTGTA[C/A]WGCTACTCCAKGATAACACTAACCRTCATGCRCACTCGGWTGATRGGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: