zgc:113291

Ensembl ID:
ENSDARG00000026359
ZFIN ID:
ZDB-GENE-050417-456
Description:
hypothetical protein LOC550596 [Source:RefSeq peptide;Acc:NP_001017897]
Human Orthologue:
PBLD
Human Description:
phenazine biosynthesis-like protein domain containing [Source:HGNC Symbol;Acc:23301]
Mouse Orthologues:
3110049J23Rik, Pbld
Mouse Descriptions:
phenazine biosynthesis-like protein domain containing Gene [Source:MGI Symbol;Acc:MGI:1915621]
RIKEN cDNA 3110049J23 gene Gene [Source:MGI Symbol;Acc:MGI:1914557]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11289 Nonsense Available for shipment Available now
sa19059 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007382 Nonsense 173 182 9 9
ENSDART00000056512   None 286 None 9
ENSDART00000138563 Nonsense 277 286 9 9
ENSDART00000007382 Nonsense 173 182 9 9
ENSDART00000056512   None 286 None 9
ENSDART00000138563 Nonsense 277 286 9 9

The following transcripts of ENSDARG00000026359 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22990180)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22719518
GRCz11 13 22849968
KASP Assay ID:
2260-6344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTGGARGTGAGAGATGATGGTCGAGTAAACATCAKTGGTCGGGCA[C/T]AAATCATTCTTCAGGGAACTCTTAAAGTCTAGTCAAGTCATGCAAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007382 Nonsense 173 182 9 9
ENSDART00000056512   None 286 None 9
ENSDART00000138563 Nonsense 277 286 9 9
ENSDART00000007382 Nonsense 173 182 9 9
ENSDART00000056512   None 286 None 9
ENSDART00000138563 Nonsense 277 286 9 9

The following transcripts of ENSDARG00000026359 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22990180)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22719518
GRCz11 13 22849968
KASP Assay ID:
2260-6344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGGAGGTGAGAGATGATGGTCGAGTAAACATCATTGGTCGGGCA[C/T]AAATCATTCTTCAGGGAACTCTTAAAGTCTAGTCAAGTCATGCAAATCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link