styxl1

Ensembl ID:
ENSDARG00000026338
ZFIN ID:
ZDB-GENE-040912-45
Description:
serine/threonine/tyrosine-interacting-like protein 1 [Source:RefSeq peptide;Acc:NP_001004619]
Human Orthologue:
STYXL1
Human Description:
serine/threonine/tyrosine interacting-like 1 [Source:HGNC Symbol;Acc:18165]
Mouse Orthologue:
Styxl1
Mouse Description:
serine/threonine/tyrosine interacting-like 1 Gene [Source:MGI Symbol;Acc:MGI:1923821]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21779 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028940 Nonsense 242 295 7 8
Genomic Location (Zv9):
Chromosome 10 (position 36284004)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35316706
GRCz11 10 35260566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTCTCTACTCTTGGGAAAAGCAGATGCTGTGCTGTTGCAATGGCATA[T/G]CTTATGTCTCACTTGAAATACACAATAAAGGTAATATTTTGTGGTCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link