zgc:103654

Ensembl ID:
ENSDARG00000026322
ZFIN ID:
ZDB-GENE-041114-58
Description:
hypothetical protein LOC492491 [Source:RefSeq peptide;Acc:NP_001007364]
Human Orthologue:
DHRS13
Human Description:
dehydrogenase/reductase (SDR family) member 13 [Source:HGNC Symbol;Acc:28326]
Mouse Orthologue:
Dhrs13
Mouse Description:
dehydrogenase/reductase (SDR family) member 13 Gene [Source:MGI Symbol;Acc:MGI:1917701]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27654 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099320 Nonsense 148 296 4 5
Genomic Location (Zv9):
Chromosome 10 (position 38133890)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36856828
GRCz11 10 36800586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAAACGGTTAAAAGAGTGCGGTCCCAGCAGAATCGTAACCGTCTCTT[C/A]GATGGCCCATGCGTGGGGGAAAATGGATTTCAACTGCATCAACGCTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link