slc46a1

Ensembl ID:
ENSDARG00000026149
ZFIN ID:
ZDB-GENE-040426-1012
Description:
Proton-coupled folate transporter [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWG6]
Human Orthologue:
SLC46A1
Human Description:
solute carrier family 46 (folate transporter), member 1 [Source:HGNC Symbol;Acc:30521]
Mouse Orthologue:
Slc46a1
Mouse Description:
solute carrier family 46, member 1 Gene [Source:MGI Symbol;Acc:MGI:1098733]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32038 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037119 Nonsense 221 481 2 6
Genomic Location (Zv9):
Chromosome 15 (position 27527223)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28245463
GRCz11 15 28178339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGGCTTGCCTGGGATTGGCTGGCATGTTTGCAAGCATCATTGGAGGA[C/T]AGTGGAGACGGGCCCAAGGGTATTTCATTTTTTCTTCTAAATTGGAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link