zgc:114137

Ensembl ID:
ENSDARG00000026137
ZFIN ID:
ZDB-GENE-050706-107
Description:
sideroflexin-5 [Source:RefSeq peptide;Acc:NP_001025334]
Human Orthologue:
SFXN5
Human Description:
sideroflexin 5 [Source:HGNC Symbol;Acc:16073]
Mouse Orthologue:
Sfxn5
Mouse Description:
sideroflexin 5 Gene [Source:MGI Symbol;Acc:MGI:2137681]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19095 Nonsense Mutation detected in F1 DNA During 2018
sa9855 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034606 Nonsense 57 325 3 15
ENSDART00000034606 Nonsense 57 325 3 15
Genomic Location (Zv9):
Chromosome 14 (position 48254867)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46327447
GRCz11 14 45314739
KASP Assay ID:
2260-7888.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATAGAGTCGTTTAAAAGAATGTATGAAACTCCTGGATGATTTCAAA[C/T]GAGGGAATCTTCCTGCAGGTGTCACAGATCAGCAGGTGATGTTTAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034606 Nonsense 57 325 3 15
ENSDART00000034606 Nonsense 57 325 3 15
Genomic Location (Zv9):
Chromosome 14 (position 48254867)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46327447
GRCz11 14 45314739
KASP Assay ID:
2260-7888.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTSATAGAGTCGTTTAAAAGAATGTATGAAACTCCTGGATGATTTCAAA[C/T]GAGGGAATCTTCCTGCAGGWGTCACAGATCAGCAGGTGATGTTTWGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link