slc48a1b

Ensembl ID:
ENSDARG00000026109
ZFIN ID:
ZDB-GENE-030131-8226
Description:
Heme transporter hrg1-A [Source:UniProtKB/Swiss-Prot;Acc:Q7T3B2]
Human Orthologue:
SLC48A1
Human Description:
solute carrier family 48 (heme transporter), member 1 [Source:HGNC Symbol;Acc:26035]
Mouse Orthologue:
Slc48a1
Mouse Description:
solute carrier family 48 (heme transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1914989]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40741 Nonsense Mutation detected in F1 DNA During 2018
sa40742 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20758 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029930 Nonsense 12 144 2 4
ENSDART00000131347 Nonsense 12 107 1 2
ENSDART00000143616 Nonsense 12 107 2 3
Genomic Location (Zv9):
Chromosome 6 (position 38827400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38899000
GRCz11 6 38896536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGACGACAGGAATGGCGTTCAATAAGACGTATATTCGCGTGGGCTA[C/A]TCGTGTATGGGGATGCTGGTGGGCTTTTCGGCGTTTCTGGTGTGGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029930 Essential Splice Site 43 144 2 4
ENSDART00000131347 Essential Splice Site 43 107 1 2
ENSDART00000143616 Essential Splice Site 43 107 2 3
Genomic Location (Zv9):
Chromosome 6 (position 38827495)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38899095
GRCz11 6 38896631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACATCGCTTACAAACAGCCGTGGACCGCCGCGATGGGAGGATTATCAG[G/A]TAAATTCCTTGGCTGTGTCTCAAGGTGAACTAACCAACTTAACATAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029930 Essential Splice Site 44 144 None 4
ENSDART00000131347 Essential Splice Site 44 107 None 2
ENSDART00000143616 Essential Splice Site 44 107 None 3
Genomic Location (Zv9):
Chromosome 6 (position 38827496)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38899096
GRCz11 6 38896632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCGCTTACAAACAGCCGTGGACCGCCGCGATGGGAGGATTATCAGG[T/A]AAATTCCTTGGCTGTGTCTCAAGGTGAACTAACCAACTTAACATAGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link