zgc:110829

Ensembl ID:
ENSDARG00000025912
ZFIN ID:
ZDB-GENE-050320-130
Description:
hypothetical protein LOC541427 [Source:RefSeq peptide;Acc:NP_001013571]
Human Orthologue:
BSCL2
Human Description:
Berardinelli-Seip congenital lipodystrophy 2 (seipin) [Source:HGNC Symbol;Acc:15832]
Mouse Orthologue:
Bscl2
Mouse Description:
Bernardinelli-Seip congenital lipodystrophy 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:129839

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42340 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128638 Essential Splice Site 283 391 6 8
Genomic Location (Zv9):
Chromosome 14 (position 6175169)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 5862166
GRCz11 14 6169000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGCTTCCTGCAGTTTAACCTCAATGGTCGCCAGTTTCGCAGAAAGG[T/A]GCGCTTTCATTTTTTAATATACCTGTAGTGAGTAAGTCTAGTGAGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link