zgc:56178

Ensembl ID:
ENSDARG00000025882
ZFIN ID:
ZDB-GENE-040426-928
Description:
Zgc:56178 [Source:UniProtKB/TrEMBL;Acc:Q7ZV75]
Human Orthologue:
RPAP3
Human Description:
RNA polymerase II associated protein 3 [Source:HGNC Symbol;Acc:26151]
Mouse Orthologue:
Rpap3
Mouse Description:
RNA polymerase II associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1277218]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037888 Nonsense 21 178 1 4
Genomic Location (Zv9):
Chromosome 4 (position 737958)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 954596
GRCz11 4 968044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGCGCTGGAGCTGCAGATTCAGATGCGACACAACGCTGAAGATCTG[C/T]AGAGCTTTATGAGGGATCTGGACAGCTGGGAGGACGAGATCAAGCAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link