wu:fi22e09

Ensembl ID:
ENSDARG00000025868
ZFIN IDs:
ZDB-GENE-030131-5878, ZDB-GENE-041212-79
Description:
zinc finger, DHHC-type containing 13 [Source:RefSeq peptide;Acc:NP_001008650]
Human Orthologue:
ZDHHC13
Human Description:
zinc finger, DHHC-type containing 13 [Source:HGNC Symbol;Acc:18413]
Mouse Orthologue:
Zdhhc13
Mouse Description:
zinc finger, DHHC domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1919227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13890 Nonsense Available for shipment Available now
sa17046 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103361 Nonsense 19 645 2 17
Genomic Location (Zv9):
Chromosome 7 (position 17287674)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16261009
GRCz11 7 16512982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMTTGTAAAAATTTACAGTCCCACTCCCATGGKCACATGGGTGACAGTTG[C/A]CATGGACATGGCGGTGGCCACTCCCATGGACACGGACACAGTCATGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103361 Essential Splice Site 434 645 11 17
Genomic Location (Zv9):
Chromosome 7 (position 17309777)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16282978
GRCz11 7 16534951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACTGACCCAGGAYACGTCAAGGCCACCGAGGAGGARAAGAARAAGG[T/A]AAGAGCGGCCTGGCAGTGGCNNNNNNNNNTGTTCATCTAATTGCACAGTAGAKATGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link