zgc:56525

Ensembl ID:
ENSDARG00000025858
ZFIN ID:
ZDB-GENE-040426-1060
Description:
hypothetical protein LOC393249 [Source:RefSeq peptide;Acc:NP_956573]
Human Orthologue:
GOLM1
Human Description:
golgi membrane protein 1 [Source:HGNC Symbol;Acc:15451]
Mouse Orthologue:
Golm1
Mouse Description:
golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34494 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032355 Essential Splice Site 104 411 None 10
ENSDART00000125264 Essential Splice Site 104 411 None 9

The following transcripts of ENSDARG00000025858 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51360977)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49111364
GRCz11 8 49100133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCACAGACAGCAGGAGAACGCTATCAACAGCTGGAGACAGGAAAAAG[T/C]AGGAAAACACTCATTCAGTACTCACTCAGTAATCAGCTGGTTACATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link