abhd2a

Ensembl ID:
ENSDARG00000025797
ZFIN ID:
ZDB-GENE-040426-784
Description:
Abhydrolase domain-containing protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q802V6]
Human Orthologue:
ABHD2
Human Description:
abhydrolase domain containing 2 [Source:HGNC Symbol;Acc:18717]
Mouse Orthologue:
Abhd2
Mouse Description:
abhydrolase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914344]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31551 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035067 Nonsense 109 432 4 11
Genomic Location (Zv9):
Chromosome 7 (position 14707981)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13588994
GRCz11 7 13839433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGGTCAGTTCACCGCACCCGTTCGGCCTGCGCAAATATCTGCCCATG[C/T]AGGACGGAGCCACTGCAACTTTTGACCTCTTCGAACCCTTGGCGGATCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link