wu:fd12d03

Ensembl ID:
ENSDARG00000025789
ZFIN IDs:
ZDB-GENE-030131-4532, ZDB-GENE-030131-4532
Description:
Wu:fd12d03 protein [Source:UniProtKB/TrEMBL;Acc:A9JRU7]
Human Orthologue:
CHD4
Human Description:
chromodomain helicase DNA binding protein 4 [Source:HGNC Symbol;Acc:1919]
Mouse Orthologue:
Chd4
Mouse Description:
chromodomain helicase DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1344380]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13914 Nonsense Available for shipment Available now
sa16797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042209 Nonsense 267 1074 6 21
ENSDART00000092902 Nonsense 267 1953 5 39
Genomic Location (Zv9):
Chromosome 16 (position 34005910)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31828394
GRCz11 16 31783982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGCCCACGACAACAGCAGCTCCTGTCGCTGCMCCACCCCCACCCCAG[C/T]AGCCCCCAGCAGTCCCACTGCGGAAAGCCAAGAYCAAAGAGGGCAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042209 Nonsense 397 1074 9 21
ENSDART00000092902 Nonsense 397 1953 8 39
Genomic Location (Zv9):
Chromosome 16 (position 34004649)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31827133
GRCz11 16 31782721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAGCAGGGYGGWGAGATCATTCTGTGTGACACCTGTCCCAGAGCCTA[T/G]CACATGGTCTGTCTGGATCCTGACATGGAGAGGGCACYAGAGGGTACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link