zgc:66440

Ensembl ID:
ENSDARG00000025766
ZFIN ID:
ZDB-GENE-040426-1640
Description:
protein deltex-3 [Source:RefSeq peptide;Acc:NP_956822]
Human Orthologue:
DTX3
Human Description:
deltex homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:24457]
Mouse Orthologue:
Dtx3
Mouse Description:
deltex 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37726 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078357 Essential Splice Site 266 290 3 4
ENSDART00000124482 Essential Splice Site 336 360 3 4
ENSDART00000128718 Essential Splice Site 360 384 3 4
ENSDART00000133249   None 28 None 2
ENSDART00000138751   None 97 None 3
ENSDART00000142324   None 53 None 3
Genomic Location (Zv9):
Chromosome 23 (position 27284742)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27117564
GRCz11 23 27044105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAATGATATCCACCACAAGACCTCTATATGGGGTGGACCACGATGG[T/G]ATGTCTTTTAAAACATGTTTGCTAAATTATGTCTGAGCAATATGTGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link