zgc:64085

Ensembl ID:
ENSDARG00000025757
ZFIN ID:
ZDB-GENE-040426-1362
Description:
hypothetical protein LOC393380 [Source:RefSeq peptide;Acc:NP_956702]
Human Orthologue:
TSPAN1
Human Description:
tetraspanin 1 [Source:HGNC Symbol;Acc:20657]
Mouse Orthologue:
Tspan1
Mouse Description:
tetraspanin 1 Gene [Source:MGI Symbol;Acc:MGI:1914055]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19962 Essential Splice Site Available for shipment Available now
sa13078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033638 Essential Splice Site 108 234 5 8
ENSDART00000140577 Essential Splice Site 117 243 5 8
Genomic Location (Zv9):
Chromosome 3 (position 14238382)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14483889
GRCz11 3 14633689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTATGCATACTGATGGAAATAGCCATGGCTCTTCTTTTGTGTATTTC[A/C]GGCAGAAACGCTGATTAAACAGTTGGGAGTTGATGCTGTGAAAAGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033638 Nonsense 190 234 7 8
ENSDART00000140577 Nonsense 199 243 7 8
Genomic Location (Zv9):
Chromosome 3 (position 14240073)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14485580
GRCz11 3 14635380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAKCTTTATATTTGTGTKTGTTTTCCYCCWAGACTGTMACAGGTTG[T/A]TTTCCAGCACWGATAAAGCTGGTGGATAAAAATGCCGTTATCATCATAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link