zgc:114170

Ensembl ID:
ENSDARG00000025670
ZFIN ID:
ZDB-GENE-050913-111
Description:
follistatin-related protein 3 [Source:RefSeq peptide;Acc:NP_001025282]
Human Orthologue:
FSTL3
Human Description:
follistatin-like 3 (secreted glycoprotein) [Source:HGNC Symbol;Acc:3973]
Mouse Orthologue:
Fstl3
Mouse Description:
follistatin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1890391]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6704 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034851 Essential Splice Site 88 246 3 5
ENSDART00000144402 Essential Splice Site 63 210 2 3
Genomic Location (Zv9):
Chromosome 22 (position 19114887)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18865822
GRCz11 22 18890800
KASP Assay ID:
554-5101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTACTTATRCTCTACATTTTCTCACTTTATCCAYTTTCTTTCATATAC[A/T]GAGAACTGTGAAGGAGTGAACTGTGGCCTTGGAAAGGTGTGTAGAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link