zgc:77177

Ensembl ID:
ENSDARG00000025593
ZFIN ID:
ZDB-GENE-040426-2480
Description:
Pleckstrin homology domain-containing family J member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0G8]
Human Orthologue:
PLEKHJ1
Human Description:
pleckstrin homology domain containing, family J member 1 [Source:HGNC Symbol;Acc:18211]
Mouse Orthologue:
Plekhj1
Mouse Description:
pleckstrin homology domain containing, family J member 1 Gene [Source:MGI Symbol;Acc:MGI:1925920]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39957 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037279 Nonsense 63 158 3 6

The following transcripts of ENSDARG00000025593 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 58675506)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57741918
GRCz11 2 57856681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGCCTCTTTCTGTGTGTTTACAGCCCATCGGCGCTCTGCTGCTGGAA[C/T]AGTGTCGTGTGGAGAGAGAAGATCCTCAGGTTTTCTCTATCGGTAAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link