zgc:66447

Ensembl ID:
ENSDARG00000025577
ZFIN ID:
ZDB-GENE-030131-4748
Description:
SLAIN motif-containing protein-like [Source:UniProtKB/Swiss-Prot;Acc:Q7SXC6]
Human Orthologue:
SLAIN2
Human Description:
SLAIN motif family, member 2 [Source:HGNC Symbol;Acc:29282]
Mouse Orthologue:
Slain2
Mouse Description:
SLAIN motif family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1923241]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35649 Nonsense Available for shipment Available now
sa7231 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029366 Nonsense 134 585 2 9
Genomic Location (Zv9):
Chromosome 14 (position 12308784)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11744557
GRCz11 14 12050571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACACCTCCAGGGTAGAGGAGCAGGATGGGTTTCTAAGCTTACCGTG[T/A]TCTTCTGGCTCCAAACAAACCATGGGATGGTTTGTCACAAGTAACTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029366 Essential Splice Site 321 585 5 9
Genomic Location (Zv9):
Chromosome 14 (position 12299470)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11735243
GRCz11 14 12041257
KASP Assay ID:
554-4487.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGGATCTGACTGATGTTCAGATAATGGCTCGCCTGCAAGAGGAGAG[T/G]AAGTATCATTCATGAGACACAATTCTTGACTAYAAGTGTTTTTTTACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link