nf2b

Ensembl ID:
ENSDARG00000025567
ZFIN ID:
ZDB-GENE-040622-3
Description:
neurofibromin 2b (merlin) [Source:RefSeq peptide;Acc:NP_998116]
Human Orthologue:
NF2
Human Description:
neurofibromin 2 (merlin) [Source:HGNC Symbol;Acc:7773]
Mouse Orthologue:
Nf2
Mouse Description:
neurofibromatosis 2 Gene [Source:MGI Symbol;Acc:MGI:97307]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45738 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13486 Nonsense Available for shipment Available now
sa23946 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035062   94 586 4 17
ENSDART00000128987   94 586 3 16
ENSDART00000136146 Essential Splice Site 73 96 None 11
Genomic Location (Zv9):
Chromosome 21 (position 25184869)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25768206
GRCz11 21 25804811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCAAAGGACTCTCCGATAACATTTCACTTTCTTGCTAAATTCTTCCC[A/T]GAAAAAGTTGAGGACGAGCTCGTTCAGGAAATTACTCAGCACCTCTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035062 Nonsense 125 586 5 17
ENSDART00000128987 Nonsense 125 586 4 16
ENSDART00000136146   None 96 5 11
Genomic Location (Zv9):
Chromosome 21 (position 25185112)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25768449
GRCz11 21 25805054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGNTTTTTTTACAAAGGTTAAAAAGCAGATACTAGATGAGGAGATATTTTG[T/A]TCTCCAGAAGCCTCCGTTCTTTTAGCCTCATATGCTGTTCAAGCCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035062 Nonsense 261 586 9 17
ENSDART00000128987 Nonsense 261 586 8 16
ENSDART00000136146   None 96 9 11
Genomic Location (Zv9):
Chromosome 21 (position 25187652)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25770989
GRCz11 21 25807594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTAACAAATCCTTCCCCTGGAGTGGAATCCGAAACATCTCCTACAGC[G/T]AGAAAGAGGTTGAAAGATTACCTCTTTTTTTAAACACAAAATATGCAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link