zgc:101654

Ensembl ID:
ENSDARG00000025555
ZFIN ID:
ZDB-GENE-041010-190
Description:
ORM1-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJR6]
Human Orthologue:
ORMDL3
Human Description:
ORM1-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:16038]
Mouse Orthologue:
Ormdl3
Mouse Description:
ORM1-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038310 Nonsense 88 153 3 4
ENSDART00000132731 Nonsense 31 85 4 5
Genomic Location (Zv9):
Chromosome 12 (position 23589307)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22112670
GRCz11 12 22233889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CSTTTGAGACTCCGGACCAAGGCAAGGCCCGGCTTCTGACACACTGGGAA[C/T]AGAWGGACTATGGTGWCCAGTTCACCGCCTCCCGAAAGTTTCTCACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link