si:dkey-7l6.7

Ensembl ID:
ENSDARG00000025513
ZFIN ID:
ZDB-GENE-070912-589
Description:
Novel protein similar to vertebrate DIP2 disco-interacting protein 2 homolog C (Drosophila) (DIP2C)
Human Orthologue:
DIP2C
Human Description:
DIP2 disco-interacting protein 2 homolog C (Drosophila) [Source:HGNC Symbol;Acc:29150]
Mouse Orthologue:
Dip2c
Mouse Description:
DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19842 Nonsense Available for shipment Available now
sa14089 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025997 Nonsense 688 1595 18 39
ENSDART00000141399 Nonsense 591 1488 15 35
Genomic Location (Zv9):
Chromosome 2 (position 42631592)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42681056
GRCz11 2 42530474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACATGGGCTTGAGGTCAGAGGTCATATGCCCATGTGCTGGTTCCCCC[G/T]AGGCTCTAACCGTCGCTCTGAGGAGGTATAAACACACACTCGCACTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025997 Essential Splice Site 858 1595 21 39
ENSDART00000141399 Essential Splice Site 761 1488 18 35
Genomic Location (Zv9):
Chromosome 2 (position 42625531)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42674995
GRCz11 2 42524413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCTACCGCTCTGGCTGTGGAGCCCATGAAGTTCATCTACAGAGGAAG[G/A]TGAGTGGGTCARAGACAAAAAANCGTCACTTTTTTNGGTGTCCACATCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link